crispr guide rna design tool (Benchling Inc)
86
Structured Review
Benchling Inc
crispr guide rna design tool
Crispr Guide Rna Design Tool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+grna+design+tool/crispr+design+tool/pmc13155868-62-34-40
Average 86 stars, based on 1 article reviews
Crispr Guide Rna Design Tool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+grna+design+tool/crispr+design+tool/pmc13155868-62-34-40
Average 86 stars, based on 1 article reviews
crispr guide rna design tool - by Bioz Stars,
2026-10
86/100 stars
Images
Related Articles
CRISPR:Article Title: Streptococcus pyogenes EVs induce the alternative inflammasome via caspase-4/-5 in human monocytes Article Snippet: .. Guide RNAs (gRNA) designed with Article Title: Stereoselective methyl-swapping demonstrates target specificity of cognitive enhancer Article Snippet: .. For CRISPR editing of the EIF2B4 gene in HEK293-Flp-In-T-rex cells, guide RNAs were designed using the Benchling Article Title: Neural crest and periderm-specific requirements of Irf6 during neural tube and craniofacial development Article Snippet: .. Guide RNAs (gRNA) were designed within the intronic regions flanking exons 3 and 4 using the Article Title: Abnormal nucleoli architecture and aggregate formation in nucleophosmin mutated acute myeloid leukaemia Article Snippet: .. DNA oligonucleotides (forward, 5′-ACATGGACATGAGCCCCCTG-3′; reverse 5′-GATAGTTCTGGGGCCTCAGG-3′) used for gRNA synthesis were designed using the Benchling Article Title: Abnormal nucleoli architecture and aggregate formation in Nucleophosmin mutated Acute Myeloid Leukaemia. Article Snippet: .. Generation of fluorescently tagged NPM1 HeLa cells using CRISPR/Cas9mediated gene editing DNA oligonucleotides (Forward 5’ ACATGGACATGAGCCCCCTG 3’, Reverse 5’ GATAGTTCTGGGGCCTCAGG 3’) used for gRNA synthesis were designed using the Benchling Article Title: Selective genome editing of amplified oncogenes triggers immunogenic cell death and tumor remodeling Article Snippet: .. sgRNAs were designed using the Benchling Mutagenesis:Article Title: Stereoselective methyl-swapping demonstrates target specificity of cognitive enhancer Article Snippet: .. For CRISPR editing of the EIF2B4 gene in HEK293-Flp-In-T-rex cells, guide RNAs were designed using the Benchling other:Article Title: Massively parallel in vivo Perturb-seq screening. Article Snippet: Advances in genomics have identified thousands of risk genes impacting human health and diseases, but the functions of these genes and their mechanistic contribution to disease are often unclear.. Moving beyond identification to actionable biological pathways requires dissecting risk gene function and cell type-specific action in intact tissues.. This gap can in part be addressed by in vivo Perturb-seq, a method that combines state-of-the-art gene editing tools for programmable perturbation of genes with highcontent, high-resolution single-cell genomic assays as phenotypic readouts. Clone Assay:Article Title: Abnormal nucleoli architecture and aggregate formation in Nucleophosmin mutated Acute Myeloid Leukaemia. Article Snippet: .. Generation of fluorescently tagged NPM1 HeLa cells using CRISPR/Cas9mediated gene editing DNA oligonucleotides (Forward 5’ ACATGGACATGAGCCCCCTG 3’, Reverse 5’ GATAGTTCTGGGGCCTCAGG 3’) used for gRNA synthesis were designed using the Benchling Article Title: Selective genome editing of amplified oncogenes triggers immunogenic cell death and tumor remodeling Article Snippet: .. sgRNAs were designed using the Benchling Transformation Assay:Article Title: Abnormal nucleoli architecture and aggregate formation in Nucleophosmin mutated Acute Myeloid Leukaemia. Article Snippet: .. Generation of fluorescently tagged NPM1 HeLa cells using CRISPR/Cas9mediated gene editing DNA oligonucleotides (Forward 5’ ACATGGACATGAGCCCCCTG 3’, Reverse 5’ GATAGTTCTGGGGCCTCAGG 3’) used for gRNA synthesis were designed using the Benchling Plasmid Preparation:Article Title: Selective genome editing of amplified oncogenes triggers immunogenic cell death and tumor remodeling Article Snippet: .. sgRNAs were designed using the Benchling Article Title: Selective genome editing of amplified oncogenes triggers immunogenic cell death and tumor remodeling. Article Snippet: Dose-dependent treatments with DOX (S1208, Selleckchem) were applied: 0.02 μM for IMR-32A, 0.1 μM for LAN-5A, 0.3 μM for KELLYA, 0.5 μM for SK-N-FINA and 1.75 μM for SK-N-ASNA. tdTomato+ IMR-32A cells were generated via transduction with LVs using the pUltra-Chili-Luc transfer plasmid (Addgene #48688), followed by cell sorting. .. All cell lines were regularly tested to absence of mycoplasma contamination. sgRNA design and vector construction. sgRNAs were designed using the Benchling Expressing:Article Title: Selective genome editing of amplified oncogenes triggers immunogenic cell death and tumor remodeling Article Snippet: .. sgRNAs were designed using the Benchling Article Title: Selective genome editing of amplified oncogenes triggers immunogenic cell death and tumor remodeling. Article Snippet: Dose-dependent treatments with DOX (S1208, Selleckchem) were applied: 0.02 μM for IMR-32A, 0.1 μM for LAN-5A, 0.3 μM for KELLYA, 0.5 μM for SK-N-FINA and 1.75 μM for SK-N-ASNA. tdTomato+ IMR-32A cells were generated via transduction with LVs using the pUltra-Chili-Luc transfer plasmid (Addgene #48688), followed by cell sorting. .. All cell lines were regularly tested to absence of mycoplasma contamination. sgRNA design and vector construction. sgRNAs were designed using the Benchling |